علوم زيستي ورزشي _ بهار 1390 شمارة 8- ص ص : 87- 71
تاريخ دريافت : 05 / 02 / 89 تاريخ تصويب : 24 / 05 / 89

بيان MSTN و MyoD در پاسخ به تمرين مقاومتي در عضلات تند و كند انقباض موش
ورزيده و غير ورزيده نر ويستار

عباس فلاح _ رضا قراخانلو _ مسعود سليماني
كارشناس ارشد دانشگاه تربيت مدرس، دانشيار دانشگاه تربيت مدرس، استاديار دانشگاه تربيت مدرس

چكيده
هدف از اين تحقيق، بررسي تاثير يك وهله تمرين مقاومتي وامانده ساز بر مايوستاتين و MyoD، در عضلات اسكلتي موشهاي نر نـژاد ويستار بود . 30 موش به سه گروه تقسيم شدند: كنترل ( 6 سر ) ، غيرورزيده ( 12سر) و ورزيده (12 سر). تمرين مقـاومتي شـاملبالابردن وزنه روي نردبان بود. 48 ساعت پس از اخرين جلسه تمريني هر دو گروه غيرورزيده و ورزيده يك جلسه تمرين مقـاومتيوامانده ساز را انجام دادند و 3 و 6 ساعت بعد قرباني شدند. بيان مايوستاتين و MyoD در نعلي و خم كنندة دراز شست بـا تكنيـك Real time – PCR اندازه گيري و داده ها با روش CT∆∆-2 محاسبه شدند .تفاوت ها با t-test زوجي و مستقل تعيـين شـدند.
بيان myoD ،3 و 6 ساعت پس از آخرين جلسة تمرين در نعلي نسبت به گروه كنترل، در گروه ورزيـده بـه ترتيـب 54/1 برابـركاهش و 07/1 برابر افزايش و در گروه غيرورزيده 86/2 و 4 برابر كاهش يافت. بيان myoD ،3 و6 ساعت پـس از آخـرين جلسـة تمرين در خمكنندة دراز شست نسبت به گروه كنترل، درگروه ورزيده به ترتيب 70 و 339 برابـر و در گـروه غيرورزيـده 193 و 206 برابر افزايش يافت. در بررسي بيان مايوستاتين 6 و 3 ساعت پس از تمرين درنعلي ، در گروه ورزيده داده اي يافـت نشـد و در گروه غيرورزيده 3 ساعت پس از يك جلسه تمرين نسبت به گروه كنترل 854 برابركاهش يافت و6 ساعت پس از يك جلسه تمرين داده اي يافت نشد. بيان مايوستاتين 3 و 6 ساعت پس از آخرين جلس ة تمرين در خم كنند ة دراز شست نسـبت بـه گـروه كنتـرل ، در گـروه ورزيـده بـه ترتيـب 87/15 و 39/1 برابـر كـاهش و در گـروه غيرورزيـده 59 و 151 برابـر افـزايش يافـت. يافتـه هـا، پاسـخ هـاي متفاوت مايوستاتين وMyoD را به يك جلسه تمرين واماندهساز مقاومتي در عضلات تند وكند مـوش هـاي ورزيـده و غيرورزيـدهآشكار مي سازد.

واژه هاي كليدي
تمرين مقاومتي، MyoD ،Real time – PCR، مايوستاتين، نعلي، خم كنندة دراز شست.
مقدمه
خانوادةMRF شامل Myogenin، Myf5 ، myoDو MRF4مي شود. myoD يكي از اولين ماركرهاي الزامي در عضلهزايي و يك پروتئين با نقش كليـدي در تنظـيم تمـايز عضـله اسـت (3،1). myoD بـه خـانوادة پروتئين هايي كه به عنوان عوامل تنظيم كنندة عضله زايي شناخته ميشوند، تعلق دارد. اين فاكتورهاي رونويسـيبه صورت پي در پي در تمايز عضلهزايي شركت ميكنند(4،2،1). اين فاكتور در سلولهاي ماهواره اي فعال بيان ميشود ولي در سلولهاي ماهوارهاي خاموش بيان نميشود (1،3) . سطوح mRNA اين پپتايد بين عضلات كند وتند متفاوت است كه اين نكته نشان مي دهد كهMyoD ممكن است جنبه هايي از نوع فيبر را تنظيم كند. نشان دادهشده كه پروتئينهاي MyoD طي تكوين به هستة فيبرهاي نوع تندتر در عضلات تند محدود ميشود(5).
مايواستاتين (MSTN) عضوي از زيرمجموعة TGF βاست كه به خوبي بـين گونـه هـا حفـظ شـده و يـك تنظيمكنندة منفي قوي براي تودة عضلاني است (7،6). اين ژن مورد توجه ويـژه اي اسـت ، زيـرا ديـده شـده كـهMSTN تأثيراتي عميق بر روي عضلاني شدن چهارپايان، موش، انسـان و ديگـر حيوانـات دارد. MSTN، بـهعنوان يك هدف درماني بالقوه براي بهبود سلامتي عضلات معرفي شده است و در عضله زايي درگير است (7،6) .
در موشهايي كه MSTN شان ناك اوت شد، 2 تا 3 برابر افـزايش در تـودة عضـله نسـبت بـه گـروه كنتـرلمشاهده شد. بهعلاوه گزارش شده كه بيوزني، اضافه بار و تمرين، بيان MSTN را تغيير مي دهند(8،9).
شرايط درگير در لاغري يا مرتبط با اختلال هاي تركيب بدني بسيار وسيع و شامل ديستروفي عضلات، پيري، آسيب هاي
نخاعي ، آسيب هاي ورزشي، بيماري هاي انحطاط اعصاب ، آتروفي هاي ناشي از عدم تحرك، استراحت در رختخواب يا بي وزني و ديابت ميليتوس است(11،10).
اين شرايط، دركاهش تودة عضلات و كاهش قدرت و عملكرد نقش دارند و همچنين مي توانند به ناتواني ودر موارد زيادي مرگ منجر شوند كه اغلب به دليل نتيجه مستقيم يا غيرمستقيم كاهش قدرت و تودة عضلات اسكلتي است. علت اين شرايط اغلب چندين عاملي است كه مي تواند درگير در اختلال در بيان چندين ژن يا چندين مسير سيگنالينگ باشد (13،12،11،10).
تمرين مقاومتي فزاينده، تودة عضلاني و قدرت آن را افزايش مي دهد. اين تمرين به افزايش قدرت و افزايش مقطع عرضي فيبر عضلات به ويژه در پروتئين هاي ميوفيبريل اكتين و ميوزين منجر مي شود و يكي از موثرترين راه هاي هايپرتروفي است (13) .
جدا از اينكه تمرين مقاومتي بخشي اساسي را در برنامة تمرينات ورزشكاران بسياري از رشته ها در بر دارد، براي بهبود بسياري از بيماري ها و تناسب اندام نيز بسيار مفيد است، زيرا در تحقيقات جالبي مشاهده شده است كه تمرين مقاومتي تاثيرات مفيدتري نسبت به تمرين هوازي در كاهش چربي دارد و اين تحقيق نشان داد كه تمرين مقاومتي ممكن است در بهبود تركيب بدني مشاركت داشته باشد (12) .
از آنجا كه ديده شده عوامل تمايزي ويژ ة عضله زايي مانند MyoD و ژن مهاركننـد ة عضـله زايـي MSTN از آتروفي و هايپرتروفي تاثير گرفتهاند، تمرين مقاومتي براي اين تحقيق در نظر گرفته شد. عضلة اسكلتي يك بافت با خصوصيت تغييرپذيري زياد است كه تحت تغييرات فيزيولوژيكي و بيوشيميايي مختلفي در پاسخ به تحريكاتيمانند تمرين و فعاليت بدني قرار ميگيرد .تمرين مقاومتي يك محرك بالقوهاي براي افزايش سنتز پروتئين عضلهاست كه به هايپرتروفي عضلاني و افزايش قدرت مي انجامد. بنا براين، هدف از پژوهش حاضر بررسي اثر سازگاري ناشي از تمرين مقاومتي بر پاسخ عضلاتFHL ( خمكنندة دراز شست) وSOL (نعلي) به يـك جلسـه تمـرينمقاومتي، از نظر بيانmyoD و MSTN است.

روش تحقيق
نگهداري از حيوانات، تمرين مقاومتي و تهي ة بافت ها
30 سر موش صحرا يي 2 ماهه نر با وزن 15 ±270 از مركز حيوانات رازي تهيه و به طور تصادفي بـه چهـار گروه تقسيم شدند:كنترل (6 سر) ، تمرين يك جلسهاي (غيرورزيده، 12 سر ) و تمرين دوره اي (ورزيده، 12 سر ).
پروتكل تمريني براي گروه تمرين دوره اي شامل 8 هفته تمرين مقاومتي بود. هر يك از گـروه هـاي تمـرين يـك جلسهاي و تمرين دورهاي به دو گروه شش تايي تقسيم شدند .6 حيوان از گروه تمرين يـك جلسـهاي 3 سـاعتپس از تمرين و 6 سر باقيمانده 6 ساعت پس از تمرين قرباني شدند. به طور مشابه در گروه تمرين دورهاي نيـز 6 موش 3 ساعت پس از آخرين جلس ة تمريني و 6 سر باقيمانده 6 ساعت پـس از آخـرين جلسـة تمرينـي قربـانيشدند. انجام اين تحقيق توسط كميته اخلاق تحقيقاتي دانشگاه تربيت مدرس تاييد شد.
موش هاي صحرا يي در سيكل استاندارد 12 ساعت روز – 12 ساعت شب نگهداري شدند. تمـرين در بعـد ازظهرها انجام شد، آب و غذاي كافي در اختيار تمامي موش هاي صحرا يي قـرار گرفـت و هـر هفتـه وزن حيوانـاتاندازه گيري ميشد. براي تمرين موش هاي ص حرايي وزنه به دم آنها متصـل شـده بـود كـه بايـد ايـن وزنـه را ازنردباني با 26 پله بالا ميبردند. در هر بار بالا رفتن، اين حيوانات 13 بار با دست و پاي چپ و 13 بار بـا دسـت وپاي راست وزنة الحاقي را ليفت ميكردند(14). گروه تمرين 8 هفته اي (ورزيده) 4 روز آشنا سازي دا شتند و پـساز 72 ساعت استراحت تمرين آنها شروع شد. وزنة تمريني اين گروه با 50 درصد وزن بدنشـان شـروع شـد و بـهتدريج طي 8 هفته به 200 درصد وزن بدن افزايش يافت. افزايش اين وزنه ها از هفتة اول تا چهارم، هر هفته 30 درصد وزن بدن و در چهار هفتة پاياني تمرين هر هفته 15 درصد وزن بدن افزايش داشتند .
گروه تمرين يك جلسهاي (غيرورزيده) پس از چهار روز آشناسازي به مـدت 72 سـاعت اسـتراحت داشـت وپس از آن يك جلسه تمرين كرد كه در طي اين جلسة تمرين با وزنهاي به جرم 50 درصد وزن بدن شـروع و تـااواخر جلسه به 100 درصد وزن بدن رسيد .گروه كنترل نيز تمام مدت تمرين را در قفس بودند.
براي هر جلسه از تمرين هر دو گروه تمريني، 4 ست با 5 تكرار در نظر گرفته شد كه بين ست ها 4 دقيقه استراحت و بين تكرارها 30 تا 45 ثانيه استراحت لحاظ شد. آخرين جلس ة تمرين هر دو گروه تا حد وامانده سازي پيش رفت. تمام گـروه ها در 3 روز پي در پي در بعدازظهر و با استفاده ازتزريق درون صفاقي تركيب كتامين(100 mg/kg body wt) و زايلازين (10 mg/kg) قرباني شدند. بعد از تشريح، بافت ها به سرعت در نيتروژن مايع منجمـد و بعـد از آن در دماي 80- درجه براي مراحل بعدي تحقيق نگهداري شدند.
استخراج RNA
استخراج RNA با استفاده از mg 50 از هر كدام از عضلاتFHL و Sol به طـور جداگانـه انجـام گرفـت . بـراياستخراجmRNA از كيت شركتBIONEER و دستورالعمل آن استفاده شد. سـپس بـراي تعيـين كيفيـتRNA استخراج شده2 ميكرو ليتر از محصول استخراج را به حجم 100 ميكروليت ر رسانده شـده و جـذب آن درطول موج هاي 260و 280 nm اندازه گيري شد ، نسبت مقدار جذب 260به 280 بين 7/1 تا 3/2 بود .
mRNA براي Real time PCR (cDNA فرايند ساختن) RT مرحلة
براي ساختنcDNA از آنزيم (Fermentase) Mo-MLV استفاده شد. به اين منظـور 5 ميكروگـرم ازمحصول RNA ي مذكور براساس دستور شركت سـازنده برداشـته شـده و طـي مراحـل زيـر از آنهـاcDNA ساخته شد : 5 ميكروگرمRNA با 2/0 ميكروگرم راندوم هگزامر مخلوط و با آبDEPC خورده بـه حجـم 20 ميكروليتر رسانده شد. مخلوط مذكور در 70 درجه براي 5 دقيقه انكوبه و سپس بلافاصله بر روي يخ منتقـل شـدتا ساختارهاي ثانويةRNA از هم باز شوند و فرصت كافي براي ساخته شدن مجدد نداشته باشـند .بـه مخلـوطبافر X 5 به ميزان 6 ميكرو ليتر،Mm 10dNTP به ميزان 3 ميكروليتر و سپس به آن 200 واحد آنـزيم RT اضافه شد. حجم كل به 30 ميكروليتر رسانده شد. مخلوط ابتدا به مدت 10 دقيقه در 25 درجه و 15 دقيقـه 37 درجه و سپس به مدت 45 دقيقه در 42 درج ة سانتي گراد و 10 دقيقـه در 75 درجـه سـانتي گـراد انكوبـه شـد.
محصول cDNA به دست آمده در دماي 20- درجه نگهداري شد (12).
پرايمرها: در اين تحقيق پرايمرها براي بررسي سطح بيانmyoD ،mRNA و MSTN به همراهRPL26 ژن House keeping با TM~60 و سايز بين 100تا 150 جفت باز طراحـي شـدند كـه مشخصـات آنهـا درجـدول 1 آورده شـده اسـت. بـراي Real Time-PCR از SYBR Green شـركتfermentase آلمـاناستفاده شد.
جدول 1 _ مشخصات پرايمرها
Gene Accession Number Forward primer (5´→3΄) Reverse primer (5´→3΄)
Rat-myod1
Rat-MSTN Rat-Rpl26 NM_176079.1
NM_019151.1
NM_001105788.1 TCTGATGGCATGATGGATTAC
CCAACTTAGGCATTGAAATC GAAGTTCAGGTTGTTCGAGG TAGTAGGCGGCGTCGTAG ACTTCTAAAAAGGGATTCAGC GGACAGTTGTGCCGTTAGC

روش هاي آماري
در اين تحقيق Ctهاي واكنش Real timeبه وسيلة نرم افزار دستگاه (Rotor-Gene 6) Real-time PCR استخراج و ثبت شد. در نهايت اختلاف بيانMyoD وMSTN در گروه هاي تمريني باگروه كنترل با فرمول ct∆∆-2، به وسيلة نرم افزار Microsoft Excel محاسبه شد.
براي بقي ة عمليات آماري از نرمافزارSPSS استفاده شد. به منظور بررسـي نرمـال بـودن توزيـع متغيرهـا ازآزمون كولموگروف – اسمير نوف و براي تجزيه و تحليل آماري از آزمونهاي پارامتري استفاده شـد. همچنـين بـهوسيلة t-Test زوجي و مستقل مقايسة بيان هريك از فاكتورها بين عضلات كنـد و تنـد و همچنـين بـين 3 و 6 ساعت در گروه هاي مختلف انجام گرفت و p value نيز (05/0p<) گزارش شد.

نتايج و يافته هاي تحقيق
سطح بيانmyoD در عضلة SolوFHL
سطح بيان myoD ،3 و 6 ساعت پس از آخرين جلسة تمرين گروه 8 هفته (گروه ورزيـده ) در عضـل ة Sol نسبت به گروه كنترل به ترتيب 86/2 برابر كاهش و 07/1 برابر افزايش يافت. سطح بيانmyoD در گروه يـكجلسه (گروه غيرورزيده) 3 و 6 ساعت پس از تمرين در عضلة Solنسبت به گروه كنترل به ترتيـب 54/1 و 4 برابر كاهش بيان يافت (جدول 2 و شكل 1).

5

4

3

2

1
0
1
2
کنترل

گروه

به

نسبت

برابر

چند

غيير
ت
SolmyoD


1.07
1.54

2.86

4
Control

1
1

1

1
Trained
3
Trained
H
6
H
Acute
3
H
Acute
6
H

5

4

3

2



قیمت: تومان


پاسخ دهید